BMRBj - BMREntryMaster

Found 1 Document (0.424 seconds)

BMRB: 26842

6GZR

NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine

Authors

Elke, D., Juen, M., Kreutz, C., Wohnert, J.

Assembly

TMR-3 48nt-5-TAMRA

Entity

1. TMR-3 48nt-5-TAMRA (polymer, Thiol state: not present), 48 monomers, 15557.20 Da Detail

GGACGACUGA ACCGAAAGGU UCUUGGCUGC UUCGGCAGAG GUACGUCC

Formula weight

15557.2 Da

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 88.7 %, Completeness (bb): 84.7 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N	³¹P
All	88.7 % (720 of 812)	93.3 % (390 of 418)	94.7 % (303 of 320)	92.3 % (24 of 26)	6.3 % (3 of 48)
Suger, PO4	84.7 % (488 of 576)	91.0 % (262 of 288)	92.9 % (223 of 240)		6.3 % (3 of 48)
Nucleobase	98.3 % (232 of 236)	98.5 % (128 of 130)	100.0 % (80 of 80)	92.3 % (24 of 26)
Aromatic	98.1 % (208 of 212)	98.1 % (104 of 106)	100.0 % (80 of 80)	92.3 % (24 of 26)

1. TMR-3 48nt

GGACGACUGA ACCGAAAGGU UCUUGGCUGC UUCGGCAGAG GUACGUCC

Show sample condition

Sample #1

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
1	TMR-3_48nt	natural abundance	1.2 (±0.1) mM
2	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
3	D2O	natural abundance	5 v/v
4	sodium chloride	natural abundance	10 mM
5	Na-Glutamate	natural abundance	130 mM
6	H2O	natural abundance	95 v/v

Sample #2

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
7	TMR-3_48nt	[U-13C; U-15N]	1.2 (±0.1) mM
8	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
9	D2O	natural abundance	5 v/v
10	H2O	natural abundance	95 v/v
11	sodium chloride	natural abundance	10 mM
12	Na-Glutamate	natural abundance	130 mM

Sample #3

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
13	TMR-3_48nt	[U-15N]	1.2 (±0.1) mM
14	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
15	D2O	natural abundance	5 v/v
16	H2O	natural abundance	95 v/v
17	sodium chloride	natural abundance	10 mM
18	K-glutamate	natural abundance	130 mM

Sample #4

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
19	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
20	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
21	D2O	natural abundance	5 v/v
22	H2O	natural abundance	95 v/v
23	sodium chloride	natural abundance	10 mM
24	K-glutamate	natural abundance	130 mM

Sample #5

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
25	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
26	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
27	D2O	natural abundance	5 v/v
28	H2O	natural abundance	95 v/v
29	sodium chloride	natural abundance	10 mM
30	Na-Glutamate	natural abundance	130 mM

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
31	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
32	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
33	D2O	natural abundance	100 v/v
34	sodium chloride	natural abundance	10 mM
35	K-glutamate	natural abundance	130 mM

Sample #7

Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
36	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
37	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
38	D2O	natural abundance	100 v/v
39	sodium chloride	natural abundance	10 mM
40	Na-Glutamate	natural abundance	130 mM

Release date

2016-10-12

Citation

NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine
Duchardt-Ferner, E., Juen, M., Kreutz, C., Wohnert, J.
Biomol. NMR Assign. (2016), 11, 29-34, PubMed 27730489 , DOI 10.1007/s12104-016-9715-6 , Abstract

Experiments performed 29 experiments Detail

1 3D 1H-13C NOESY aromatic

Instrument

Bruker Avance - 950 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
7	TMR-3_48nt	[U-13C; U-15N]	1.2 (±0.1) mM
8	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
9	D2O	natural abundance	5 v/v
10	H2O	natural abundance	95 v/v
11	sodium chloride	natural abundance	10 mM
12	Na-Glutamate	natural abundance	130 mM

2 3D 1H-13C NOESY aliphatic

Instrument

Bruker Avance - 950 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
7	TMR-3_48nt	[U-13C; U-15N]	1.2 (±0.1) mM
8	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
9	D2O	natural abundance	5 v/v
10	H2O	natural abundance	95 v/v
11	sodium chloride	natural abundance	10 mM
12	Na-Glutamate	natural abundance	130 mM

3 3D 1H-13C NOESY aromatic

Instrument

Bruker Avance - 950 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
19	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
20	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
21	D2O	natural abundance	5 v/v
22	H2O	natural abundance	95 v/v
23	sodium chloride	natural abundance	10 mM
24	K-glutamate	natural abundance	130 mM

4 3D 1H-13C NOESY aliphatic

Instrument

Bruker Avance - 950 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
31	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
32	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
33	D2O	natural abundance	100 v/v
34	sodium chloride	natural abundance	10 mM
35	K-glutamate	natural abundance	130 mM

5 3D 1H-13C NOESY aromatic

Instrument

Bruker Avance - 950 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
25	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
26	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
27	D2O	natural abundance	5 v/v
28	H2O	natural abundance	95 v/v
29	sodium chloride	natural abundance	10 mM
30	Na-Glutamate	natural abundance	130 mM

6 3D 1H-13C NOESY aliphatic

Instrument

Bruker Avance - 950 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
36	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
37	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
38	D2O	natural abundance	100 v/v
39	sodium chloride	natural abundance	10 mM
40	Na-Glutamate	natural abundance	130 mM

7 2D 1H-1H NOESY

Instrument

Bruker Avance - 950 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
13	TMR-3_48nt	[U-15N]	1.2 (±0.1) mM
14	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
15	D2O	natural abundance	5 v/v
16	H2O	natural abundance	95 v/v
17	sodium chloride	natural abundance	10 mM
18	K-glutamate	natural abundance	130 mM

8 2D 1H-15N HSQC

Instrument

Bruker Avance - 950 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
13	TMR-3_48nt	[U-15N]	1.2 (±0.1) mM
14	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
15	D2O	natural abundance	5 v/v
16	H2O	natural abundance	95 v/v
17	sodium chloride	natural abundance	10 mM
18	K-glutamate	natural abundance	130 mM

9 2D 1H-15N HSQC NH2 only

Instrument

Bruker Avance - 950 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
13	TMR-3_48nt	[U-15N]	1.2 (±0.1) mM
14	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
15	D2O	natural abundance	5 v/v
16	H2O	natural abundance	95 v/v
17	sodium chloride	natural abundance	10 mM
18	K-glutamate	natural abundance	130 mM

10 SELLR HNN-COSY

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
13	TMR-3_48nt	[U-15N]	1.2 (±0.1) mM
14	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
15	D2O	natural abundance	5 v/v
16	H2O	natural abundance	95 v/v
17	sodium chloride	natural abundance	10 mM
18	K-glutamate	natural abundance	130 mM

11 HNN-COSY

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
13	TMR-3_48nt	[U-15N]	1.2 (±0.1) mM
14	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
15	D2O	natural abundance	5 v/v
16	H2O	natural abundance	95 v/v
17	sodium chloride	natural abundance	10 mM
18	K-glutamate	natural abundance	130 mM

12 amino HNN-COSY

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
13	TMR-3_48nt	[U-15N]	1.2 (±0.1) mM
14	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
15	D2O	natural abundance	5 v/v
16	H2O	natural abundance	95 v/v
17	sodium chloride	natural abundance	10 mM
18	K-glutamate	natural abundance	130 mM

13 H1/H8 13C-HMBC

Instrument

Bruker Avance - 800 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
25	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
26	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
27	D2O	natural abundance	5 v/v
28	H2O	natural abundance	95 v/v
29	sodium chloride	natural abundance	10 mM
30	Na-Glutamate	natural abundance	130 mM

14 2D H5(C5C4N3)H3

Instrument

Bruker Avance - 800 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
25	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
26	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
27	D2O	natural abundance	5 v/v
28	H2O	natural abundance	95 v/v
29	sodium chloride	natural abundance	10 mM
30	Na-Glutamate	natural abundance	130 mM

15 2D H5(C5C4N4)H4

Instrument

Bruker Avance - 800 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
19	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
20	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
21	D2O	natural abundance	5 v/v
22	H2O	natural abundance	95 v/v
23	sodium chloride	natural abundance	10 mM
24	K-glutamate	natural abundance	130 mM

16 2D H(C)N aromatic

Instrument

Bruker Avance - 700 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
31	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
32	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
33	D2O	natural abundance	100 v/v
34	sodium chloride	natural abundance	10 mM
35	K-glutamate	natural abundance	130 mM

17 2D H(C)N aliphatic

Instrument

Bruker Avance - 700 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
31	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
32	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
33	D2O	natural abundance	100 v/v
34	sodium chloride	natural abundance	10 mM
35	K-glutamate	natural abundance	130 mM

18 2D H(C)N aromatic

Instrument

Bruker Avance - 700 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
36	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
37	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
38	D2O	natural abundance	100 v/v
39	sodium chloride	natural abundance	10 mM
40	Na-Glutamate	natural abundance	130 mM

19 2D H(C)N aliphatic

Instrument

Bruker Avance - 700 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
36	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
37	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
38	D2O	natural abundance	100 v/v
39	sodium chloride	natural abundance	10 mM
40	Na-Glutamate	natural abundance	130 mM

20 3D HCCH-TOCSY

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
31	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
32	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
33	D2O	natural abundance	100 v/v
34	sodium chloride	natural abundance	10 mM
35	K-glutamate	natural abundance	130 mM

21 3D HCCH-TOCSY

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
36	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
37	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
38	D2O	natural abundance	100 v/v
39	sodium chloride	natural abundance	10 mM
40	Na-Glutamate	natural abundance	130 mM

22 3D HCCH-COSY

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
31	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
32	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
33	D2O	natural abundance	100 v/v
34	sodium chloride	natural abundance	10 mM
35	K-glutamate	natural abundance	130 mM

23 3D HCCH-COSY

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
36	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
37	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
38	D2O	natural abundance	100 v/v
39	sodium chloride	natural abundance	10 mM
40	Na-Glutamate	natural abundance	130 mM

24 2D H(N)CO

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
25	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
26	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
27	D2O	natural abundance	5 v/v
28	H2O	natural abundance	95 v/v
29	sodium chloride	natural abundance	10 mM
30	Na-Glutamate	natural abundance	130 mM

25 H6-C2/C4 lr13C-HSQC

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
1	TMR-3_48nt	natural abundance	1.2 (±0.1) mM
2	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
3	D2O	natural abundance	5 v/v
4	sodium chloride	natural abundance	10 mM
5	Na-Glutamate	natural abundance	130 mM
6	H2O	natural abundance	95 v/v

26 H5-N3 lr15N-HSQC

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
25	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
26	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
27	D2O	natural abundance	5 v/v
28	H2O	natural abundance	95 v/v
29	sodium chloride	natural abundance	10 mM
30	Na-Glutamate	natural abundance	130 mM

27 TROSY relayed HCCH COSY

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,15N]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
31	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
32	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
33	D2O	natural abundance	100 v/v
34	sodium chloride	natural abundance	10 mM
35	K-glutamate	natural abundance	130 mM

28 2D H(C)P

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,31P]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
31	TMR-3_48nt	[U-13C; U-15N]-Ade,Cyt	1.2 (±0.1) mM
32	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
33	D2O	natural abundance	100 v/v
34	sodium chloride	natural abundance	10 mM
35	K-glutamate	natural abundance	130 mM

29 2D H(C)P

Instrument

Bruker Avance - 600 MHz 5 mm z-gradient 1H,[13C,31P]-TCI cryogenic probe

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.5

#	Name	Isotope labeling	Concentration
36	TMR-3_48nt	[U-13C; U-15N]-Gua,Ura	1.2 (±0.1) mM
37	5-Carboxy-Tetramethylrhodamine	natural abundance	1.4 (±0.2) mM
38	D2O	natural abundance	100 v/v
39	sodium chloride	natural abundance	10 mM
40	Na-Glutamate	natural abundance	130 mM

NMR combined restraints 6 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_26842_6gzr.nef
Input source #2: Coordindates	6gzr.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	1	FH8	5-carboxy methylrhodamine	None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--------40--------
GGACGACUGAACCGAAAGGUUCUUGGCUGCUUCGGCAGAGGUACGUCC
||||||||||||||||||||||||||||||||||||||||||||||||
GGACGACUGAACCGAAAGGUUCUUGGCUGCUUCGGCAGAGGUACGUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	48	0	0	100.0

Content subtype: combined_26842_6gzr.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	957		100.0 (chain: A, length: 48)
1	Distance restraints	DYANA/DIANA_distance_constraints_3	Warning	1358 (1)	noe	100.0 (chain: A, length: 48)
2	Distance restraints	DYANA/DIANA_distance_constraints_2	Warning	116 (1)	hbond	95.8 (chain: A, length: 48)
3	Distance restraints	DYANA/DIANA_distance_constraints_4	Warning	602 (1)	hbond	100.0 (chain: A, length: 48)
1	Dihedral angle restraints	DYANA/DIANA_dihedral_5	OK	283 (283)	.	95.8 (chain: A, length: 48)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 48, Sequence coverage: 100.0%

--------10--------20--------30--------40--------
GGACGACUGAACCGAAAGGUUCUUGGCUGCUUCGGCAGAGGUACGUCC
||||||||||||||||||||||||||||||||||||||||||||||||
GGACGACUGAACCGAAAGGUUCUUGGCUGCUUCGGCAGAGGUACGUCC

Total number of assignments
- ¹H chemical shifts: 415
- ¹³C chemical shifts: 382
- ¹⁵N chemical shifts: 157
- ³¹P chemical shifts: 3

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	C5	118.551
1	G	N9	169.149
2	G	C5	118.634
2	G	N2	74.018
2	G	N9	169.321
3	A	C4	148.473
3	A	C5	120.312
3	A	C6	157.414
3	A	N1	222.326
3	A	N3	211.613
3	A	N6	83.727
3	A	N9	170.704
4	C	C4	151.049
4	C	N1	149.779
4	C	N3	195.87
4	C	N4	98.155
5	G	C4	151.162
5	G	C5	118.035
5	G	N2	74.918
5	G	N7	234.022
5	G	N9	168.424
6	A	C4	148.245
6	A	C5	120.112
6	A	C6	157.193
6	A	N1	224.497
6	A	N3	210.946
6	A	N6	82.205
6	A	N7	230.059
6	A	N9	170.416
7	C	N1	151.37
7	C	N3	195.641
7	C	N4	97.235
8	U	C2	152.35
8	U	C4	169.604
8	U	N1	147.085
9	G	H21	8.418
9	G	H22	6.424
9	G	C5	118.558
9	G	N2	75.994
9	G	N7	235.181
9	G	N9	169.914
10	A	H61	8.452
10	A	H62	6.773
10	A	C4	148.398
10	A	C5	120.971
10	A	C6	157.398
10	A	N1	221.542
10	A	N3	212.091
10	A	N6	82.867
10	A	N9	169.882
11	A	H61	8.207
11	A	H62	6.808
11	A	C4	148.325
11	A	C5	120.446
11	A	C6	157.646
11	A	N1	222.236
11	A	N3	211.321
11	A	N6	84.844
11	A	N7	229.359
11	A	N9	171.149
12	C	N1	151.017
12	C	N3	197.159
12	C	N4	98.676
13	C	N1	150.357
13	C	N3	194.707
13	C	N4	98.259
14	G	C5	118.947
14	G	N9	170.16
15	A	C4	149.045
15	A	C5	119.989
15	A	C6	156.329
15	A	N1	223.571
15	A	N3	215.702
15	A	N6	78.05
15	A	N7	228.341
15	A	N9	169.308
16	A	H61	6.494
16	A	H62	6.494
16	A	C4	147.966
16	A	C5	119.643
16	A	C6	155.818
16	A	N1	223.563
16	A	N3	215.68
16	A	N6	79.003
16	A	N7	226.254
16	A	N9	169.786
16	A	P	-0.111
17	A	C4	148.362
17	A	C5	119.718
17	A	C6	156.786
17	A	N1	226.078
17	A	N3	215.923
17	A	N6	80.176
17	A	N7	230.859
17	A	N9	172.678
17	A	P	-1.865
18	G	C5	119.19
18	G	N2	74.71
18	G	N9	169.026
19	G	H21	8.418
19	G	H22	6.743
19	G	C4	151.839
19	G	C5	118.893
19	G	N2	74.319
19	G	N9	169.234
20	U	C2	152.934
20	U	C4	168.985
20	U	N1	146.464
21	U	C2	152.703
21	U	C4	169.113
21	U	N1	147.21
22	C	N1	151.731
22	C	N3	196.547
22	C	N4	98.525
23	U	C2	154.168
23	U	C4	166.662
23	U	N1	145.523
24	U	C2	153.52
24	U	C4	167.362
24	U	N1	142.559
25	G	C2	154.752
25	G	C4	149.922
25	G	C5	119.401
25	G	C6	158.553
25	G	N2	71.495
25	G	N7	232.127
25	G	N9	170.183
26	G	H21	8.574
26	G	H22	6.623
26	G	C5	119.45
26	G	N2	73.654
26	G	N7	233.965
26	G	N9	170.44
27	C	N1	150.912
27	C	N3	197.19
27	C	N4	98.68
28	U	C2	152.403
28	U	C4	169.312
28	U	N1	145.467
29	G	C4	151.722
29	G	C5	118.481
29	G	N2	75.37
29	G	N7	233.664
29	G	N9	169.461
30	C	N1	151.122
30	C	N3	195.641
30	C	N4	99.31
31	U	C2	152.931
31	U	C4	167.816
31	U	N1	146.737
32	U	HO2'	6.574
32	U	C2	155.037
32	U	C4	168.833
32	U	N1	143.704
32	U	P	-2.072
33	C	N1	150.503
33	C	N3	202.71
33	C	N4	93.548
34	G	C2	155.493
34	G	C5	118.667
34	G	C6	161.448
34	G	N2	74.269
34	G	N7	231.367
34	G	N9	171.571
35	G	H21	8.757
35	G	H22	6.441
35	G	C2	156.89
35	G	C4	152.138
35	G	C5	119.046
35	G	C6	162.274
35	G	N2	75.511
35	G	N7	232.304
35	G	N9	170.277
36	C	N1	151.056
36	C	N3	196.615
36	C	N4	97.389
37	A	H61	6.304
37	A	H62	6.304
37	A	C4	148.229
37	A	C5	120.711
37	A	C6	156.96
37	A	N1	219.972
37	A	N3	214.036
37	A	N6	81.786
37	A	N7	229.924
37	A	N9	170.264
38	G	H21	7.165
38	G	H22	5.703
38	G	C4	151.229
38	G	C5	118.583
38	G	N2	72.976
38	G	N9	169.215
39	A	H61	6.32
39	A	H62	6.32
39	A	C4	148.092
39	A	C5	119.346
39	A	C6	157.337
39	A	N1	222.195
39	A	N3	212.282
39	A	N6	83.186
39	A	N9	170.929
40	G	H21	6.204
40	G	H22	5.925
40	G	C5	117.909
40	G	N2	77.406
40	G	N7	235.705
40	G	N9	170.941
41	G	H21	8.605
41	G	H22	6.412
41	G	C5	117.317
41	G	N2	83.378
41	G	N7	237.186
41	G	N9	161.426
42	U	C2	153.289
42	U	C4	168.878
42	U	N1	142.296
43	A	C4	150.404
43	A	C5	121.13
43	A	C6	157.63
43	A	N1	223.707
43	A	N3	217.538
43	A	N6	78.475
43	A	N7	234.084
43	A	N9	169.166
44	C	N1	151.445
44	C	N3	196.782
44	C	N4	97.127
45	G	C5	118.842
45	G	N2	74.701
45	G	N7	233.998
45	G	N9	168.063
46	U	C2	152.711
46	U	C4	168.921
46	U	N1	146.749
47	C	N1	151.672
47	C	N3	198.095
47	C	N4	98.219
48	C	N1	149.954
48	C	N3	197.952
48	C	N4	98.773

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	418	390	93.3
¹³C chemical shifts	320	303	94.7
¹⁵N chemical shifts	26	24	92.3

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	288	262	91.0
¹³C chemical shifts	240	223	92.9

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	130	128	98.5
¹³C chemical shifts	80	80	100.0
¹⁵N chemical shifts	26	24	92.3

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	36	36	100.0
¹³C chemical shifts	36	36	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: DYANA/DIANA_distance_constraints_3
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 48, Sequence coverage: 100.0%
- Total number of restraints: 1358
- Weight of restraints: 1.0 (1358)
- Potential type of restraints: upper-bound-parabolic (1358)
- Range of distance target values: 2.8, 8.0 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
    None
- Distance restraints on contact map
- Saveframe: DYANA/DIANA_distance_constraints_2
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 48, Sequence coverage: 95.8%
  - Total number of restraints: 116
  - Weight of restraints: 1.0 (116)
  - Potential type of restraints: upper-bound-parabolic (116)
  - Range of distance target values: 2.0, 4.0 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
    - Chain_ID: B
      None
  - Distance restraints on contact map
  - Saveframe: DYANA/DIANA_distance_constraints_4
    - Status: Warning
    - Experiment type: hbond
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 48, Sequence coverage: 100.0%
    - Total number of restraints: 602
    - Weight of restraints: 1.0 (602)
    - Potential type of restraints: upper-bound-parabolic (602)
    - Range of distance target values: 1.44, 5.0 (Å)
    - Histogram of distance target values
    - Histogram of discrepancy in distance target values
    - Distance restraints per residue
      - Chain_ID: A
      - Chain_ID: B
        None
    - Distance restraints on contact map

Dihedral angle restraints

Saveframe: DYANA/DIANA_dihedral_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 48, Sequence coverage: 95.8%
- Total number of restraints: 283
- Total number of restraints per polymer type: 283
- Weight of restraints: 1.0 (283)
- Potential type of restraints: square-well-parabolic (283)
- Dihedral angle restraints per residue
  - Chain_ID: A

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.424 seconds)

BMRB: 26842

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Sample #7

Experiments performed 29 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument